
PREVALENCE OF THE HEREDITARY
HEMOCHROMATOSIS MUTATIONS (C282Y, H63D
AND S65C) IN THE REPUBLIC OF MACEDONIA
Arsov T*, Petlichkovski A, Strezova A,
Jurhar-Pavlova M, Trajkov D, Spiroski M
*Corresponding Author: : Dr. Todor Arsov, Institute of Immunobiology and Human Genetics, Institutes of the Faculty of Medicine, University in Skopje, Ul. “50 Divizija” No. 6, P.O. Box 60, 1109 Skopje, Republic of Macedonia; Tel: +389 2 110 556; Fax: +389 2 110 558; e-mail: todorarsov@hotmail.com page: 11
|
MATERIALS AND METHODS
A total of 200 random DNA samples from healthy individuals (100 Macedonians, 50 Albanians and 50 Gypsies), provided by the Macedonian human DNA bank (hDNAMKD), Institute of Immunobiology and Human Genetics at Skopje, Republic of Macedonia, were genotyped for HFE mutations (C282Y, H63D and S65C). Written consent was obtained from each individual enrolled in this study. DNA was isolated from peripheral blood leukocytes by the phenol-chloroform extraction method [12]. The mutations were detected by a polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method [1,2,12]. Exon 4 was amplified in a 50 µL PCR reaction (MgCl2 1.5 µM, 2.5 U Taq Gold; Perkin Elmer, Roche Molecular Systems, Inc., Branchburg, NJ, USA; Tm 62EC, 40 cycles) and exon 2 in a 100 mL PCR reaction (MgCl2 2.0 µM, 2.5U Taq Gold; Perkin Elmer; Tm 62EC, 40 cycles), on a 96-well thermal cycler (PTC-100; MJ Research, Inc., Waltham, MA, USA) [14,15]. Twenty mL of the PCR products and 5 U of the corresponding restriction enzyme were used for the digestion reaction (buffer, temperature and time according to the manufacturer's recommendations; New England Biolabs (UK), Ltd., Hitchin, Hertfordshire, UK). The restriction fragments were visualized after electrophoresis in 3% agarose gel stained with ethidium bromide. The primers and restriction enzymes used are shown in Table 1. Quality control was ascertained by participation in the UK NEQAS HFE quality control scheme 5, 2001 (an international system of external quality control provided by UK NEQAS; 20 external quality control samples analyzed; accuracy result 100%).
Table 1. Primers and restriction enzymes used for the diagnosis of HFE mutations [8,14-16]
Mutation |
Forward Primer (5'÷3') |
Reverse Primer (5'÷3') |
Restriction Enzyme |
C282Y exon 4 |
TGGCAAGGGTAAACAGATCC |
CTCAGGCACTCCTCTCAACC |
RsaI; SnaBI |
H63D exon 2 |
ACATGGTTAAGGCCTGTTGC |
CTTGCTGTGGTTGTGATTTTCC |
MboI, BclI |
S65C exon 2 |
ACATGGTTAAGGCCTGTTGC |
CTTGCTGTGGTTGTGATTTTCC |
HinfI |
|
|
|
|



 |
Number 27 VOL. 27 (2), 2024 |
Number 27 VOL. 27 (1), 2024 |
Number 26 Number 26 VOL. 26(2), 2023 All in one |
Number 26 VOL. 26(2), 2023 |
Number 26 VOL. 26, 2023 Supplement |
Number 26 VOL. 26(1), 2023 |
Number 25 VOL. 25(2), 2022 |
Number 25 VOL. 25 (1), 2022 |
Number 24 VOL. 24(2), 2021 |
Number 24 VOL. 24(1), 2021 |
Number 23 VOL. 23(2), 2020 |
Number 22 VOL. 22(2), 2019 |
Number 22 VOL. 22(1), 2019 |
Number 22 VOL. 22, 2019 Supplement |
Number 21 VOL. 21(2), 2018 |
Number 21 VOL. 21 (1), 2018 |
Number 21 VOL. 21, 2018 Supplement |
Number 20 VOL. 20 (2), 2017 |
Number 20 VOL. 20 (1), 2017 |
Number 19 VOL. 19 (2), 2016 |
Number 19 VOL. 19 (1), 2016 |
Number 18 VOL. 18 (2), 2015 |
Number 18 VOL. 18 (1), 2015 |
Number 17 VOL. 17 (2), 2014 |
Number 17 VOL. 17 (1), 2014 |
Number 16 VOL. 16 (2), 2013 |
Number 16 VOL. 16 (1), 2013 |
Number 15 VOL. 15 (2), 2012 |
Number 15 VOL. 15, 2012 Supplement |
Number 15 Vol. 15 (1), 2012 |
Number 14 14 - Vol. 14 (2), 2011 |
Number 14 The 9th Balkan Congress of Medical Genetics |
Number 14 14 - Vol. 14 (1), 2011 |
Number 13 Vol. 13 (2), 2010 |
Number 13 Vol.13 (1), 2010 |
Number 12 Vol.12 (2), 2009 |
Number 12 Vol.12 (1), 2009 |
Number 11 Vol.11 (2),2008 |
Number 11 Vol.11 (1),2008 |
Number 10 Vol.10 (2), 2007 |
Number 10 10 (1),2007 |
Number 9 1&2, 2006 |
Number 9 3&4, 2006 |
Number 8 1&2, 2005 |
Number 8 3&4, 2004 |
Number 7 1&2, 2004 |
Number 6 3&4, 2003 |
Number 6 1&2, 2003 |
Number 5 3&4, 2002 |
Number 5 1&2, 2002 |
Number 4 Vol.3 (4), 2000 |
Number 4 Vol.2 (4), 1999 |
Number 4 Vol.1 (4), 1998 |
Number 4 3&4, 2001 |
Number 4 1&2, 2001 |
Number 3 Vol.3 (3), 2000 |
Number 3 Vol.2 (3), 1999 |
Number 3 Vol.1 (3), 1998 |
Number 2 Vol.3(2), 2000 |
Number 2 Vol.1 (2), 1998 |
Number 2 Vol.2 (2), 1999 |
Number 1 Vol.3 (1), 2000 |
Number 1 Vol.2 (1), 1999 |
Number 1 Vol.1 (1), 1998 |
|
|