
ASSOCIATION OF RS35006907 POLYMORPHISM WITH RISK OF DILATED ARDIOMYOPATHY IN HAN CHINESE POPULATION Yang C, Chen F, Li Sh, Zeng X,Wang Sh, Lan J *Corresponding Author: Jianjun Lan, Panzhihua Central Hospital, Panzhihua 34# Yi kang Ave., Panzhihua 617000, People’s Rep. of China; Email: pzhzxyyxnkljj@sina.com
page: 27
|
|
MATERIALS AND METHODS
Study population
In this study, a total of 529 idiopathic DCM patients
and 600 healthy controls were recruited between March
2014 and June 2017 from the Cardiology Division of Panzhihua
central hospital in Sichuan. The diagnostic criteria
of DCM refers to the modified version of standardized
diagnostic criteria for DCM [19]. Patients with a family
history of DCM, cardiac valve disease, coronary heart
disease, hypertension, tachyarrhythmia, congenital heart
disease, pericardial disease, acute viral myocarditis, heavy
alcohol intake, skeletal myopathies, systemic diseases of a
putative autoimmune origin, diabetes, and nutrition disorders
were excluded from our study. Participants of healthy
controls are free of cardiac disease, cardiac dysfunction,
and a family history of DCM. Echocardiography was conducted
for all participants to assess their heart function.
32 human heart samples used in this study were obtained
between April 2015 and July 2017 from patients who received
heart transplants at Tongji Hospital, Tongji Medical
College, Huazhong University of Science and Technology.
Our study was in accordance with the principles of the
Helsinki Declaration and approved by the Review Board
of Tongji College of Medicine and Panzhihua central
hospital. All patients have signed the informed consent.
Detailed about clinical characteristics of patients are listed
in Supplemental Table 1
Genotyping
Genomic DNA extraction from peripheral leucocytes
were finished using a DNA isolation kit in accordance
with the protocol (TIANGEN, Beijing, China) and quantified
by a NanoDrop 2000 Spectrophotometer (NanoDrop
Technologies, Wilmington, DE). The final concentration
of the samples ranged from 10 to 30 ng/mL. Probe and
primer for rs35006907 genotyping were purchased from
ThermoFisher (Assay ID: C____449430_10). The variant
rs35006907 was genotyped using a TaqMan assay on the
TaqMan 7900HT Sequence Detection System (Applied
Biosystems, Foster City, CA) with the following condition:
10 min at 95 °C (enzyme activation) followed by 45 cycles
at 95 °C for 15 s and 60 °C for 1 min (annealing/extension).
Plasmids construction, cell culture, transient
transfection, and luciferase activity assays
To investigate the effect of rs35006907 on transcription
activity of MTSS1, we constructed the reporter
plasmids using PGL3-promoter. Related primer and restriction
enzyme cutting sites are shown below: Forward
primer with KpnI 5’ GGTACCGCACAATTTGCCAATGAGTTCAAAG
3’, reverse primer with MluI 5’ ACGCGTGGGAGAGGTTTACCAGCAGAAG
3’. AC16 and
HEK293T were used for the luciferase reporter assay.
Details about cell culture and transient transfection procedures
have been described previously [20]. Cells were harvested
36 to 48 hours after transfection using the Passive
Lysis Buffer (SIRIUS, Pforzheim, Germany). The data of
luciferase expression levels were adjusted with reference
to Renilla luciferase activity and relative to the average
values of wild‐type variant. Six independent experiments
were conducted for each reporter to avoid potential errors.
Western blotting for MTSS1
A total of 20ug of protein extracts for each sample were
denatured in sample buffer (SDS polyacrylamide) containing
β-mercaptoethanol and electrophoretically resolved by
10% SDS-polyacrylamide gels, followed by transferring to
polyvinylidene difluoride membranes. Non-specific binding
sites were blocked with 5% non-fat milk for 2 h at room
temperature. Subsequently, the membranes were incubated
with primary antibodies (anti-MTSS1 and GAPDH antibodies
were purchased from ABclonal, article number: A11697
and AC002) overnight at 4 °C, followed by incubation with
a peroxidase-conjugated secondary antibody. Bands were
visualized by enhanced chemiluminescence reagents (Pierce
Chemical, Rockford, IL) and quantified by densitometry.
Realtime fluorescence quantitative PCR
To determine the effect of rs35006907 on MTSS1
expression, we collected 126 samples of peripheral blood
lymphocytes from participants undergoing coronary angiography.
Total RNA was extracted from the peripheral
blood lymphocytes using the RNeasy Mini Kit (Qiagen)
and DNase-treated with DNA-free reagent (Promega),
and then converted to cDNA in 20ul of reverse transcriptase
reaction with random hexamers (Roche Diagnostics)
and Moloney murine leukemia virus reverse transcriptase
(Promega). The mRNA levels of MTSS1 and GAPDH were
measured using realtime fluorescence quantitative PCR
with each sample in triplicate. Relevant primer sequences
and detailed characteristics of individuals are shown on
Supplemental Table 2 and 3, respectively. Expression of
MTSS1 relative to GAPDH was compared among individuals
with different genotype.
Statistical Analysis
SPSS version 13.0 (SPSS, Inc, Chicago, Illinois) for
Windows (Microsoft Corp, Redmond, WA) and Prism
(GraphPad) were used for the statistical analyses in our
study. Normality was assessed using Shapiro–Wilk’s test
with SPSS version 13.0. Polymorphism was tested for
Hardy‐Weinberg equilibrium (HWE) among the DCM patients
and controls using χ2 test with SPSS version 13.0. We
conducted binary logistic regression to test the association
of rs35006907 with DCM in different genetic models (additive,
dominant and recessive models) using SPSS version
13.0. The odds ratio (OR) and its 95% confidence intervals
(95% CIs) were calculated to evaluate the effect of any differences
between alleles or genotypes with SPSS version
13.0. The Mann–Whitney U test was used for comparison
between two continuous data with Prism (GraphPad), while
categorical data were compared using Pearson’s chi-square
test. Data are expressed as mean ± SEM of n experiments.
P<0.05 was considered to be significant.
|
|
|
|



 |
Number 28 Vol 28 2025 Supplement |
Number 27 VOL. 27 (2), 2024 |
Number 27 VOL. 27 (1), 2024 |
Number 26 Number 26 VOL. 26(2), 2023 All in one |
Number 26 VOL. 26(2), 2023 |
Number 26 VOL. 26, 2023 Supplement |
Number 26 VOL. 26(1), 2023 |
Number 25 VOL. 25(2), 2022 |
Number 25 VOL. 25 (1), 2022 |
Number 24 VOL. 24(2), 2021 |
Number 24 VOL. 24(1), 2021 |
Number 23 VOL. 23(2), 2020 |
Number 22 VOL. 22(2), 2019 |
Number 22 VOL. 22(1), 2019 |
Number 22 VOL. 22, 2019 Supplement |
Number 21 VOL. 21(2), 2018 |
Number 21 VOL. 21 (1), 2018 |
Number 21 VOL. 21, 2018 Supplement |
Number 20 VOL. 20 (2), 2017 |
Number 20 VOL. 20 (1), 2017 |
Number 19 VOL. 19 (2), 2016 |
Number 19 VOL. 19 (1), 2016 |
Number 18 VOL. 18 (2), 2015 |
Number 18 VOL. 18 (1), 2015 |
Number 17 VOL. 17 (2), 2014 |
Number 17 VOL. 17 (1), 2014 |
Number 16 VOL. 16 (2), 2013 |
Number 16 VOL. 16 (1), 2013 |
Number 15 VOL. 15 (2), 2012 |
Number 15 VOL. 15, 2012 Supplement |
Number 15 Vol. 15 (1), 2012 |
Number 14 14 - Vol. 14 (2), 2011 |
Number 14 The 9th Balkan Congress of Medical Genetics |
Number 14 14 - Vol. 14 (1), 2011 |
Number 13 Vol. 13 (2), 2010 |
Number 13 Vol.13 (1), 2010 |
Number 12 Vol.12 (2), 2009 |
Number 12 Vol.12 (1), 2009 |
Number 11 Vol.11 (2),2008 |
Number 11 Vol.11 (1),2008 |
Number 10 Vol.10 (2), 2007 |
Number 10 10 (1),2007 |
Number 9 1&2, 2006 |
Number 9 3&4, 2006 |
Number 8 1&2, 2005 |
Number 8 3&4, 2004 |
Number 7 1&2, 2004 |
Number 6 3&4, 2003 |
Number 6 1&2, 2003 |
Number 5 3&4, 2002 |
Number 5 1&2, 2002 |
Number 4 Vol.3 (4), 2000 |
Number 4 Vol.2 (4), 1999 |
Number 4 Vol.1 (4), 1998 |
Number 4 3&4, 2001 |
Number 4 1&2, 2001 |
Number 3 Vol.3 (3), 2000 |
Number 3 Vol.2 (3), 1999 |
Number 3 Vol.1 (3), 1998 |
Number 2 Vol.3(2), 2000 |
Number 2 Vol.1 (2), 1998 |
Number 2 Vol.2 (2), 1999 |
Number 1 Vol.3 (1), 2000 |
Number 1 Vol.2 (1), 1999 |
Number 1 Vol.1 (1), 1998 |
|
|
|