ASSOCIATION OF RS35006907 POLYMORPHISM WITH RISK OF DILATED ARDIOMYOPATHY IN HAN CHINESE POPULATION
Yang C, Chen F, Li Sh, Zeng X,Wang Sh, Lan J
*Corresponding Author: Jianjun Lan, Panzhihua Central Hospital, Panzhihua 34# Yi kang Ave., Panzhihua 617000, People’s Rep. of China; Email: pzhzxyyxnkljj@sina.com
page: 27

MATERIALS AND METHODS

Study population In this study, a total of 529 idiopathic DCM patients and 600 healthy controls were recruited between March 2014 and June 2017 from the Cardiology Division of Panzhihua central hospital in Sichuan. The diagnostic criteria of DCM refers to the modified version of standardized diagnostic criteria for DCM [19]. Patients with a family history of DCM, cardiac valve disease, coronary heart disease, hypertension, tachyarrhythmia, congenital heart disease, pericardial disease, acute viral myocarditis, heavy alcohol intake, skeletal myopathies, systemic diseases of a putative autoimmune origin, diabetes, and nutrition disorders were excluded from our study. Participants of healthy controls are free of cardiac disease, cardiac dysfunction, and a family history of DCM. Echocardiography was conducted for all participants to assess their heart function. 32 human heart samples used in this study were obtained between April 2015 and July 2017 from patients who received heart transplants at Tongji Hospital, Tongji Medical College, Huazhong University of Science and Technology. Our study was in accordance with the principles of the Helsinki Declaration and approved by the Review Board of Tongji College of Medicine and Panzhihua central hospital. All patients have signed the informed consent. Detailed about clinical characteristics of patients are listed in Supplemental Table 1 Genotyping Genomic DNA extraction from peripheral leucocytes were finished using a DNA isolation kit in accordance with the protocol (TIANGEN, Beijing, China) and quantified by a NanoDrop 2000 Spectrophotometer (NanoDrop Technologies, Wilmington, DE). The final concentration of the samples ranged from 10 to 30 ng/mL. Probe and primer for rs35006907 genotyping were purchased from ThermoFisher (Assay ID: C____449430_10). The variant rs35006907 was genotyped using a TaqMan assay on the TaqMan 7900HT Sequence Detection System (Applied Biosystems, Foster City, CA) with the following condition: 10 min at 95 °C (enzyme activation) followed by 45 cycles at 95 °C for 15 s and 60 °C for 1 min (annealing/extension). Plasmids construction, cell culture, transient transfection, and luciferase activity assays To investigate the effect of rs35006907 on transcription activity of MTSS1, we constructed the reporter plasmids using PGL3-promoter. Related primer and restriction enzyme cutting sites are shown below: Forward primer with KpnI 5’ GGTACCGCACAATTTGCCAATGAGTTCAAAG 3’, reverse primer with MluI 5’ ACGCGTGGGAGAGGTTTACCAGCAGAAG 3’. AC16 and HEK293T were used for the luciferase reporter assay. Details about cell culture and transient transfection procedures have been described previously [20]. Cells were harvested 36 to 48 hours after transfection using the Passive Lysis Buffer (SIRIUS, Pforzheim, Germany). The data of luciferase expression levels were adjusted with reference to Renilla luciferase activity and relative to the average values of wild‐type variant. Six independent experiments were conducted for each reporter to avoid potential errors. Western blotting for MTSS1 A total of 20ug of protein extracts for each sample were denatured in sample buffer (SDS polyacrylamide) containing β-mercaptoethanol and electrophoretically resolved by 10% SDS-polyacrylamide gels, followed by transferring to polyvinylidene difluoride membranes. Non-specific binding sites were blocked with 5% non-fat milk for 2 h at room temperature. Subsequently, the membranes were incubated with primary antibodies (anti-MTSS1 and GAPDH antibodies were purchased from ABclonal, article number: A11697 and AC002) overnight at 4 °C, followed by incubation with a peroxidase-conjugated secondary antibody. Bands were visualized by enhanced chemiluminescence reagents (Pierce Chemical, Rockford, IL) and quantified by densitometry. Realtime fluorescence quantitative PCR To determine the effect of rs35006907 on MTSS1 expression, we collected 126 samples of peripheral blood lymphocytes from participants undergoing coronary angiography. Total RNA was extracted from the peripheral blood lymphocytes using the RNeasy Mini Kit (Qiagen) and DNase-treated with DNA-free reagent (Promega), and then converted to cDNA in 20ul of reverse transcriptase reaction with random hexamers (Roche Diagnostics) and Moloney murine leukemia virus reverse transcriptase (Promega). The mRNA levels of MTSS1 and GAPDH were measured using realtime fluorescence quantitative PCR with each sample in triplicate. Relevant primer sequences and detailed characteristics of individuals are shown on Supplemental Table 2 and 3, respectively. Expression of MTSS1 relative to GAPDH was compared among individuals with different genotype. Statistical Analysis SPSS version 13.0 (SPSS, Inc, Chicago, Illinois) for Windows (Microsoft Corp, Redmond, WA) and Prism (GraphPad) were used for the statistical analyses in our study. Normality was assessed using Shapiro–Wilk’s test with SPSS version 13.0. Polymorphism was tested for Hardy‐Weinberg equilibrium (HWE) among the DCM patients and controls using χ2 test with SPSS version 13.0. We conducted binary logistic regression to test the association of rs35006907 with DCM in different genetic models (additive, dominant and recessive models) using SPSS version 13.0. The odds ratio (OR) and its 95% confidence intervals (95% CIs) were calculated to evaluate the effect of any differences between alleles or genotypes with SPSS version 13.0. The Mann–Whitney U test was used for comparison between two continuous data with Prism (GraphPad), while categorical data were compared using Pearson’s chi-square test. Data are expressed as mean ± SEM of n experiments. P<0.05 was considered to be significant.



Number 28
Vol 28 2025 Supplement
Number 27
VOL. 27 (2), 2024
Number 27
VOL. 27 (1), 2024
Number 26
Number 26 VOL. 26(2), 2023 All in one
Number 26
VOL. 26(2), 2023
Number 26
VOL. 26, 2023 Supplement
Number 26
VOL. 26(1), 2023
Number 25
VOL. 25(2), 2022
Number 25
VOL. 25 (1), 2022
Number 24
VOL. 24(2), 2021
Number 24
VOL. 24(1), 2021
Number 23
VOL. 23(2), 2020
Number 22
VOL. 22(2), 2019
Number 22
VOL. 22(1), 2019
Number 22
VOL. 22, 2019 Supplement
Number 21
VOL. 21(2), 2018
Number 21
VOL. 21 (1), 2018
Number 21
VOL. 21, 2018 Supplement
Number 20
VOL. 20 (2), 2017
Number 20
VOL. 20 (1), 2017
Number 19
VOL. 19 (2), 2016
Number 19
VOL. 19 (1), 2016
Number 18
VOL. 18 (2), 2015
Number 18
VOL. 18 (1), 2015
Number 17
VOL. 17 (2), 2014
Number 17
VOL. 17 (1), 2014
Number 16
VOL. 16 (2), 2013
Number 16
VOL. 16 (1), 2013
Number 15
VOL. 15 (2), 2012
Number 15
VOL. 15, 2012 Supplement
Number 15
Vol. 15 (1), 2012
Number 14
14 - Vol. 14 (2), 2011
Number 14
The 9th Balkan Congress of Medical Genetics
Number 14
14 - Vol. 14 (1), 2011
Number 13
Vol. 13 (2), 2010
Number 13
Vol.13 (1), 2010
Number 12
Vol.12 (2), 2009
Number 12
Vol.12 (1), 2009
Number 11
Vol.11 (2),2008
Number 11
Vol.11 (1),2008
Number 10
Vol.10 (2), 2007
Number 10
10 (1),2007
Number 9
1&2, 2006
Number 9
3&4, 2006
Number 8
1&2, 2005
Number 8
3&4, 2004
Number 7
1&2, 2004
Number 6
3&4, 2003
Number 6
1&2, 2003
Number 5
3&4, 2002
Number 5
1&2, 2002
Number 4
Vol.3 (4), 2000
Number 4
Vol.2 (4), 1999
Number 4
Vol.1 (4), 1998
Number 4
3&4, 2001
Number 4
1&2, 2001
Number 3
Vol.3 (3), 2000
Number 3
Vol.2 (3), 1999
Number 3
Vol.1 (3), 1998
Number 2
Vol.3(2), 2000
Number 2
Vol.1 (2), 1998
Number 2
Vol.2 (2), 1999
Number 1
Vol.3 (1), 2000
Number 1
Vol.2 (1), 1999
Number 1
Vol.1 (1), 1998

 

 


 About the journal ::: Editorial ::: Subscription ::: Information for authors ::: Contact
 Copyright © Balkan Journal of Medical Genetics 2006