Inactivation of p53 is the most common change identified in human cancer. Nucleotide alterations in p53 intron 6 have been reported to be associated with the dysregulation of p53 function and tumor development. G13964C base change functioned as dominant mutation similar to the more common missense, nonsense and splice-site mutations. To detect the G13964C variant PCR-RFLP assay was used. In this study, DNA was isolated from colon cancer tissue samples of (19 females and 16 males)35 cases diagnosed to be colon carcinoma. Tissues were collected from 35 cases with  colon cancer  ages of female 40-90(mean age 65.95±2.76) and ages of male 40-79(mean age 61.67±3.07).

Genomic DNA was extracted from parafin embedded tissues using EZNA Tissue DNA Kit (Omega) following the protocol. According to the exon 4 sequence primers P1(5’CTCCCCTGCTTGCCACAGGT3’) and P2(5’CAGTGTGCAGGGTGGCAAGT3’) (MWG-BIOTECH)  were designed. 5 µl DNA amplified in a reaction, that contained 0.2 µmol dNTP mix (Dr.Zeydanlı) , 0.5 unit Taq DNA polimerase (BIORON)  and primers , with a total volume of 50 µl. The PCR was performed with 10pmol 0.5 µl (P1+ P2) for 36 cycles ( predenaturing  for 5 min at 95°C, denaturing for 30 second  at  95°C  , annealing  for 30 second  at 59°C  and extension for 35 second at 72°C)  in thermal cycler (Primus 96 Advanced, Peqlab) for  amplification product of 207 bp. 15 µl of  PCR products was dilueted with 4 μl of 6X loading dye (Dr.Zeydanlı)  and separated in %1 agarose gel (Serva) stained with ethidium bromide (Dr.Zeydanlı) and observed under UV-Light transilluminator (CSL). After then 7th exon of p53 were amplified by PCR method and p53 mutation analyses was performed using by BstHHI restriction enzyme determined for 7th exon.

In this study, we found that mutations were present in 30 (85.7%) of 35 cases enrolled into study. Corresponding statistical analysis in 7 (23.3%) cases G/G , 21 (70.0%) cases G/C and 2(6.7%) C/C genotypes were found. In 5 (14.3%) were not obtained DNA isolation.

Our results indicate that individuals heterozygotes for the GC allele have high frequency than other alleles and according to the this statistical results that colon cancer may be related GC allel frequency.